ࡱ> "8#$%&'()*+,-./0123456789:;<=>?@AZ  !"#$%&'()*+,-./01234567F_:;<=>?@ABCDYGHIJKLMNOPQRSTUVWX[]^\f`cabedgkhqijrlmnoptusvz~wxy{|}Root Entry$ F`h9@eSummaryInformation(2);@H?CAED1H,@H?dA/B6H 8@H?;C8DE @H??wElDj>D/H@H??wElDj;E$H@HBExE(H +gE"NameTableTypeColumn_ValidationIdentifierNString categoryText;Formatted;Template;Condition;Guid;Path;Version;Language;Identifier;Binary;UpperCase;LowerCase;Filename;Paths;AnyPath;WildCardFilename;RegPath;KeyFormatted;CustomSource;Property;Cabinet;Shortcut;URLYDescriptionSetCategoryKeyColumnKeyTableMaxValueMinValueNullableName of columnTextDescription of columnColumn to which foreign key connectsFor foreign key, Name of table to which data must linkMaximum value allowedMinimum value allowedY;N;@Whether the column is nullableSet of values that are permittedName of tableActionTextActionName of action to be described.Localized description displayed in progress dialog and log when action is executing.TemplateOptional localized format template used to format action data records for display during action execution.AdminExecuteSequenceName of action to invoke, either in the engine or the handler DLL.ConditionOptional expression which skips the action if evaluates to expFalse.If the expression syntax is invalid, the engine will terminate, returning iesBadActionData.SequenceNumber that determines the sort order in which the actions are to be executed. Leave blank to suppress action.AdminUISequenceAdvtExecuteSequenceAdvtUISequenceAppIdActivateAtStorageGuidDllSurrogateLocalServiceRemoteServerNameFormattedRunAsInteractiveUserServiceParametersAppSearchPropertyThe property associated with a SignatureSignature_Signature;RegLocator;IniLocator;DrLocator;CompLocatorThe Signature_ represents a unique file signature and is also the foreign key in the Signature, RegLocator, IniLocator, CompLocator and the DrLocator tables.BBControlAttributesA 32-bit word that specifies the attribute flags to be applied to this control.Name of the control. This name must be unique within a billboard, but can repeat on different billboard.Billboard_BillboardExternal key to the Billboard table, name of the billboard.HeightHeight of the bounding rectangle of the control.A string used to set the initial text contained within a control (if appropriate).The type of the control.WidthWidth of the bounding rectangle of the control.XHorizontal coordinate of the upper left corner of the bounding rectangle of the control.Vertical coordinate of the upper left corner of the bounding rectangle of the control.The name of an action. The billboard is displayed during the progress messages received from this action.Name of the billboard.Feature_FeatureAn external key to the Feature Table. The billboard is shown only if this feature is being installed.OrderingA positive integer. If there is more than one billboard corresponding to an action they will be shown in the order defined by this column.BinaryDataThe unformatted binary data.Unique key identifying the binary data.BindImageFile_FileThe index into the File table. This must be an executable file.PathPathsA list of ; delimited paths that represent the paths to be searched for the import DLLS. The list is usually a list of properties each enclosed within square brackets [] .CCPSearchCheckBoxA named property to be tied to the item.ValueThe value string associated with the item.ClassAppId_Optional AppID containing DCOM information for associated application (string GUID).Argumentoptional argument for LocalServers.Class registration attributes.CLSIDThe CLSID of an OLE factory.Component_ComponentRequired foreign key into the Component Table, specifying the component for which to return a path when called through LocateComponent.ContextThe numeric server context for this server. CLSCTX_xxxxDefInprocHandlerFilename1;2;3Optional default inproc handler. Only optionally provided if Context=CLSCTX_LOCAL_SERVER. Typically "ole32.dll" or "mapi32.dll"Localized description for the Class.Required foreign key into the Feature Table, specifying the feature to validate or install in order for the CLSID factory to be operational.FileTypeMaskOptional string containing information for the HKCRthis CLSID) key. If multiple patterns exist, they must be delimited by a semicolon, and numeric subkeys will be generated: 0,1,2...Icon_IconOptional foreign key into the Icon Table, specifying the icon file associated with this CLSID. Will be written under the DefaultIcon key.IconIndexOptional icon index.ProgId_DefaultProgIdOptional ProgId associated with this CLSID.ComboBoxOrderA positive integer used to determine the ordering of the items within one list. The integers do not have to be consecutive.A named property to be tied to this item. All the items tied to the same property become part of the same combobox.The visible text to be assigned to the item. Optional. If this entry or the entire column is missing, the text is the same as the value.The value string associated with this item. Selecting the line will set the associated property to this value.CompLocatorComponentIdA string GUID unique to this component, version, and language.The table key. The Signature_ represents a unique file signature and is also the foreign key in the Signature table.A boolean value that determines if the registry value is a filename or a directory location.ComplusForeign key referencing Component that controls the ComPlus component.ExpTypeComPlus component attributes.Remote execution option, one of irsEnumPrimary key used to identify a particular component record.A conditional statement that will disable this component if the specified condition evaluates to the 'True' state. If a component is disabled, it will not be installed, regardless of the 'Action' state associated with the component.Directory_DirectoryRequired key of a Directory table record. This is actually a property name whose value contains the actual path, set either by the AppSearch action or with the default setting obtained from the Directory table.KeyPathFile;Registry;ODBCDataSourceEither the primary key into the File table, Registry table, or ODBCDataSource table. This extract path is stored when the component is installed, and is used to detect the presence of the component and to return the path to it.Expression evaluated to determine if Level in the Feature table is to change.Reference to a Feature entry in Feature table.LevelNew selection Level to set in Feature table if Condition evaluates to TRUE.ControlName of the control. This name must be unique within a dialog, but can repeat on different dialogs. Control_NextThe name of an other control on the same dialog. This link defines the tab order of the controls. The links have to form one or more cycles!Dialog_DialogExternal key to the Dialog table, name of the dialog.HelpThe help strings used with the button. The text is optional. The name of a defined property to be linked to this control. ControlConditionDefault;Disable;Enable;Hide;ShowThe desired action to be taken on the specified control.A standard conditional statement that specifies under which conditions the action should be triggered.Control_A foreign key to the Control table, name of the control.A foreign key to the Dialog table, name of the dialog.ControlEventA value to be used as a modifier when triggering a particular event.A standard conditional statement that specifies under which conditions an event should be triggered.A foreign key to the Control table, name of the controlEventAn identifier that specifies the type of the event that should take place when the user interacts with control specified by the first two entries.An integer used to order several events tied to the same control. Can be left blank.CreateFolderForeign key into the Component table.Primary key, could be foreign key into the Directory table.CustomActionPrimary key, name of action, normally appears in sequence table unless private use.SourceCustomSourceThe table reference of the source of the code.TargetExcecution parameter, depends on the type of custom actionThe numeric custom action type, consisting of source location, code type, entry, option flags.A 32-bit word that specifies the attribute flags to be applied to this dialog.Control_CancelDefines the cancel control. Hitting escape or clicking on the close icon on the dialog is equivalent to pushing this button.Control_DefaultDefines the default control. Hitting return is equivalent to pushing this button.Control_FirstDefines the control that has the focus when the dialog is created.Name of the dialog.HCenteringHorizontal position of the dialog on a 0-100 scale. 0 means left end, 100 means right end of the screen, 50 center.Height of the bounding rectangle of the dialog.TitleA text string specifying the title to be displayed in the title bar of the dialog's window.VCenteringVertical position of the dialog on a 0-100 scale. 0 means top end, 100 means bottom end of the screen, 50 center.Width of the bounding rectangle of the dialog.DefaultDirThe default sub-path under parent's path.Unique identifier for directory entry, primary key. If a property by this name is defined, it contains the full path to the directory.Directory_ParentReference to the entry in this table specifying the default parent directory. A record parented to itself or with a Null parent represents a root of the install tree.DrLocatorDepthThe depth below the path to which the Signature_ is recursively searched. If absent, the depth is assumed to be 0.ParentThe parent file signature. It is also a foreign key in the Signature table. If null and the Path column does not expand to a full path, then all the fixed drives of the user system are searched using the Path.AnyPathThe path on the user system. This is a either a subpath below the value of the Parent or a full path. The path may contain properties enclosed within [ ] that will be expanded.The Signature_ represents a unique file signature and is also the foreign key in the Signature table.DuplicateFileForeign key referencing Component that controls the duplicate file.DestFolderName of a property whose value is assumed to resolve to the full pathname to a destination folder.DestNameFilename to be given to the duplicate file.Foreign key referencing the source file to be duplicated.FileKeyPrimary key used to identify a particular file entryEnvironmentForeign key into the Component table referencing component that controls the installing of the environmental value.Unique identifier for the environmental variable settingThe name of the environmental value.The value to set in the environmental settings.ErrorInteger error number, obtained from header file IError(...) macros.MessageError formatting template, obtained from user ed. or localizers.EventMappingAttributeThe name of the control attribute, that is set when this event is received.A foreign key to the Dialog table, name of the Dialog.An identifier that specifies the type of the event that the control subscribes to.ExtensionThe extension associated with the table row.MIME_MIMEOptional Context identifier, typically "type/format" associated with the extensionProgId_Optional ProgId associated with this extension.0;1;2;4;5;6;8;9;10;16;17;18;20;21;22;24;25;26;32;33;34;36;37;38;48;49;50;52;53;54Feature attributesLonger descriptive text describing a visible feature item.UpperCaseThe name of the Directory that can be configured by the UI. A non-null value will enable the browse button.DisplayNumeric sort order, used to force a specific display ordering.Primary key used to identify a particular feature record.Feature_ParentOptional key of a parent record in the same table. If the parent is not selected, then the record will not be installed. Null indicates a root item.The install level at which record will be initially selected. An install level of 0 will disable an item and prevent its display.Short text identifying a visible feature item.FeatureComponentsForeign key into Component table.Foreign key into Feature table.Integer containing bit flags representing file attributes (with the decimal value of each bit position in parentheses)Foreign key referencing Component that controls the file.Primary key, non-localized token, must match identifier in cabinet. For uncompressed files, this field is ignored.FileNameFile name used for installation, may be localized. This may contain a "short name|long name" pair.FileSizeSize of file in bytes (long integer).LanguageList of decimal language Ids, comma-separated if more than one.Sequence with respect to the media images; order must track cabinet order.VersionVersion string for versioned files; Blank for unversioned files.FileSFPCatalogFile associated with the catalogSFPCatalog_SFPCatalogCatalog associated with the fileFontPrimary key, foreign key into File table referencing font file.FontTitleFont name.Binary stream. The binary icon data in PE (.DLL or .EXE) or icon (.ICO) format.Primary key. Name of the icon file.IniFile0;1;3The type of modification to be made, one of iifEnumForeign key into the Component table referencing component that controls the installing of the .INI value.DirPropertyForeign key into the Directory table denoting the directory where the .INI file is.The .INI file name in which to write the informationPrimary key, non-localized token.KeyThe .INI file key below Section.SectionThe .INI file Section.The value to be written.IniLocatorFieldThe field in the .INI line. If Field is null or 0 the entire line is read.The .INI file name.Key value (followed by an equals sign in INI file).Section name within in file (within square brackets in INI file).An integer value that determines if the .INI value read is a filename or a directory location or to be used as is w/o interpretation.InstallExecuteSequenceInstallUISequenceIsolatedComponentComponent_ApplicationKey to Component table item for applicationComponent_SharedKey to Component table item to be isolatedLaunchConditionExpression which must evaluate to TRUE in order for install to commence.Localizable text to display when condition fails and install must abort.ListBoxA positive integer used to determine the ordering of the items within one list..The integers do not have to be consecutive.A named property to be tied to this item. All the items tied to the same property become part of the same listbox.ListViewBinary_The name of the icon to be displayed with the icon. The binary information is looked up from the Binary Table.A named property to be tied to this item. All the items tied to the same property become part of the same listview.LockPermissionsDomainDomain name for user whose permissions are being set. (usually a property)LockObjectForeign key into Registry or File tablePermissionPermission Access mask. Full Control = 268435456 (GENERIC_ALL = 0x10000000)Directory;File;RegistryReference to another table nameUserUser for permissions to be set. (usually a property)MediaCabinetIf some or all of the files stored on the media are compressed in a cabinet, the name of that cabinet.DiskIdPrimary key, integer to determine sort order for table.DiskPromptDisk name: the visible text actually printed on the disk. This will be used to prompt the user when this disk needs to be inserted.LastSequenceFile sequence number for the last file for this media.The property defining the location of the cabinet file.VolumeLabelThe label attributed to the volume.Optional associated CLSID.ContentTypePrimary key. Context identifier, typically "type/format".Extension_Optional associated extension (without dot)ModuleComponentsComponent contained in the module.ModuleSignatureDefault language ID for module (may be changed by transform).ModuleIDModule containing the component.ModuleDependencyModule requiring the dependency.ModuleLanguageLanguage of module requiring the dependency.RequiredIDString.GUID of required module.RequiredLanguageLanguageID of the required module.RequiredVersionVersion of the required version.ModuleExclusionExcludedIDString.GUID of excluded module.ExcludedLanguageLanguage of excluded module.ExcludedMaxVersionMaximum version of excluded module.ExcludedMinVersionMinimum version of excluded module.String.GUID of module with exclusion requirement.LanguageID of module with exclusion requirement.Default decimal language of module.Module identifier (String.GUID).Version of the module.MoveFileIf this component is not "selected" for installation or removal, no action will be taken on the associated MoveFile entryName of a property whose value is assumed to resolve to the full path to the destination directoryName to be given to the original file after it is moved or copied. If blank, the destination file will be given the same name as the source filePrimary key that uniquely identifies a particular MoveFile recordOptionsInteger value specifying the MoveFile operating mode, one of imfoEnumSourceFolderName of a property whose value is assumed to resolve to the full path to the source directorySourceNameName of the source file(s) to be moved or copied. Can contain the '*' or '?' wildcards.MsiAssemblyAssembly attributesFile_ApplicationForeign key into File table, denoting the application context for private assemblies. Null for global assemblies.File_ManifestForeign key into the File table denoting the manifest file for the assembly.MsiAssemblyNameThe name part of the name-value pairs for the assembly name.The value part of the name-value pairs for the assembly name.MsiDigitalCertificateCertDataA certificate context blob for a signer certificateDigitalCertificateA unique identifier for the rowMsiDigitalSignatureDigitalCertificate_Foreign key to MsiDigitalCertificate table identifying the signer certificateHashThe encoded hash blob from the digital signatureSignObjectForeign key to Media tableReference to another table name (only Media table is supported)MsiFileHashPrimary key, foreign key into File table referencing file with this hashVarious options and attributes for this hash.HashPart1HashPart2HashPart3HashPart4MsiPatchHeadersStreamRefPrimary key. A unique identifier for the row.HeaderBinary stream. The patch header, used for patch validation.ODBCAttributeName of ODBC driver attributeDriver_ODBCDriverReference to ODBC driver in ODBCDriver tableValue for ODBC driver attributeODBCDataSourceReference to associated componentDataSourcePrimary key, non-localized.internal token for data sourceText used as registered name for data sourceDriverDescriptionReference to driver description, may be existing driverRegistrationRegistration option: 0=machine, 1=user, others t.b.d.Text used as registered name for driver, non-localizedDriverPrimary key, non-localized.internal token for driverReference to key driver fileFile_SetupOptional reference to key driver setup DLLODBCSourceAttributeName of ODBC data source attributeDataSource_Reference to ODBC data source in ODBCDataSource tableValue for ODBC data source attributeODBCTranslatorText used as registered name for translatorReference to key translator fileOptional reference to key translator setup DLLTranslatorPrimary key, non-localized.internal token for translatorPatchInteger containing bit flags representing patch attributesPrimary key, non-localized token, foreign key to File table, must match identifier in cabinet.PatchSizeSize of patch in bytes (long integer).Primary key, sequence with respect to the media images; order must track cabinet order.StreamRef_Identifier. Foreign key to the StreamRef column of the MsiPatchHeaders table.PatchPackageMedia_Foreign key to DiskId column of Media table. Indicates the disk containing the patch package.PatchIdA unique string GUID representing this patch.Class_The CLSID of an OLE factory corresponding to the ProgId.Localized description for the Program identifier.Optional foreign key into the Icon Table, specifying the icon file associated with this ProgId. Will be written under the DefaultIcon key.The Program Identifier. Primary key.ProgId_ParentThe Parent Program Identifier. If specified, the ProgId column becomes a version independent prog id.Name of property, uppercase if settable by launcher or loader.String value for property. Never null or empty.PublishComponentAppDataThis is localisable Application specific data that can be associated with a Qualified Component.A string GUID that represents the component id that will be requested by the alien product.Foreign key into the Feature table.QualifierThis is defined only when the ComponentId column is an Qualified Component Id. This is the Qualifier for ProvideComponentIndirect.RadioButtonThe height of the button.The help strings used with the button. The text is optional.A named property to be tied to this radio button. All the buttons tied to the same property become part of the same group.The visible title to be assigned to the radio button.The value string associated with this button. Selecting the button will set the associated property to this value.The width of the button.The horizontal coordinate of the upper left corner of the bounding rectangle of the radio button.The vertical coordinate of the upper left corner of the bounding rectangle of the radio button.RegistryForeign key into the Component table referencing component that controls the installing of the registry value.RegPathThe key for the registry value.The registry value name.RootThe predefined root key for the registry value, one of rrkEnum.The registry value.RegLocatorThe table key. The Signature_ represents a unique file signature and is also the foreign key in the Signature table. If the type is 0, the registry values refers a directory, and _Signature is not a foreign key.An integer value that determines if the registry value is a filename or a directory location or to be used as is w/o interpretation.RemoveFileForeign key referencing Component that controls the file to be removed.Name of a property whose value is assumed to resolve to the full pathname to the folder of the file to be removed.WildCardFilenameName of the file to be removed.InstallModeInstallation option, one of iimEnum.RemoveIniFile2;4The type of modification to be made, one of iifEnum.Foreign key into the Component table referencing component that controls the deletion of the .INI value.The .INI file name in which to delete the informationThe value to be deleted. The value is required when Action is iifIniRemoveTagRemoveRegistryForeign key into the Component table referencing component that controls the deletion of the registry value.The predefined root key for the registry value, one of rrkEnumReserveCostReserve a specified amount of space if this component is to be installed.ReserveFolderReserveKeyPrimary key that uniquely identifies a particular ReserveCost recordReserveLocalDisk space to reserve if linked component is installed locally.ReserveSourceDisk space to reserve if linked component is installed to run from the source location.SelfRegCostThe cost of registering the module.Foreign key into the File table denoting the module that needs to be registered.ServiceControlArgumentsArguments for the service. Separate by [~].Required foreign key into the Component Table that controls the startup of the serviceBit field: Install: 0x1 = Start, 0x2 = Stop, 0x8 = Delete, Uninstall: 0x10 = Start, 0x20 = Stop, 0x80 = DeleteName of a service. /, \, comma and space are invalidWaitBoolean for whether to wait for the service to fully startServiceInstallArguments to include in every start of the service, passed to WinMainDependenciesOther services this depends on to start. Separate by [~], and end with [~][~]Description of service.DisplayNameExternal Name of the ServiceErrorControlSeverity of error if service fails to startLoadOrderGroupInternal Name of the ServicePasswordpassword to run service with. (with StartName)ServiceTypeType of the serviceStartNameUser or object name to run service asStartTypeCatalogSFP CatalogDependencyParent catalog - only used by SFPFile name for the catalog.ShortcutThe command-line arguments for the shortcut.Foreign key into the Component table denoting the component whose selection gates the the shortcut creation/deletion.The description for the shortcut.Foreign key into the Directory table denoting the directory where the shortcut file is created.HotkeyThe hotkey for the shortcut. It has the virtual-key code for the key in the low-order byte, and the modifier flags in the high-order byte. Foreign key into the File table denoting the external icon file for the shortcut.The icon index for the shortcut.The name of the shortcut to be created.ShowCmd1;3;7The show command for the application window.The following values may be used.The shortcut target. This is usually a property that is expanded to a file or a folder that the shortcut points to.WkDirName of property defining location of working directory.SignatureThe name of the file. This may contain a "short name|long name" pair.LanguagesThe languages supported by the file.MaxDateThe maximum creation date of the file.MaxSizeThe maximum size of the file. MaxVersionThe maximum version of the file.MinDateThe minimum creation date of the file.MinSizeThe minimum size of the file.MinVersionThe minimum version of the file.The table key. The Signature represents a unique file signature.TextStyleColorA long integer indicating the color of the string in the RGB format (Red, Green, Blue each 0-255, RGB = R + 256*G + 256^2*B).FaceNameA string indicating the name of the font used. Required. The string must be at most 31 characters long.SizeThe size of the font used. This size is given in our units (1/12 of the system font height). Assuming that the system font is set to 12 point size, this is equivalent to the point size.StyleBitsA combination of style bits.Name of the style. The primary key of this table. This name is embedded in the texts to indicate a style change.TypeLibThe cost associated with the registration of the typelib. This column is currently optional.Optional. The foreign key into the Directory table denoting the path to the help file for the type library.Required foreign key into the Feature Table, specifying the feature to validate or install in order for the type library to be operational.The language of the library.LibIDThe GUID that represents the library.The version of the library. The minor version is in the lower 8 bits of the integer. The major version is in the next 16 bits. UITextA unique key that identifies the particular string.The localized version of the string.UpgradeActionPropertyThe property to set when a product in this set is found.The attributes of this product set.A comma-separated list of languages for either products in this set or products not in this set.RemoveThe list of features to remove when uninstalling a product from this set. The default is "ALL".UpgradeCodeThe UpgradeCode GUID belonging to the products in this set.VersionMaxThe  !"#$%&'()*+,-./012345679:<=>iDABCEGHIJKLNOPQRSTUVWXYZ[\]^`acdefkjqrstuvwxyz{|}~%%%'''+++,,,---.......7788=========BBBBPPPPPPPPTTXXZZZZZZZZ_``dddddddddddddmmmmmmzz!!!!!!!!......55566677<<????BBBBBFFFFFQQQQQQbbbdddhhhhhrrrrrr     #############::::::::::::JJJJJJJJJ[[[[[eeeeeeeemmppppppp}}}}}          # ')O' ') ') ').3261/58:8bA=J HD>BO RP >UY\Zl >):8bjol~ ewy|qgO>m>'U y|8b:lJ HD>8HD> 'g'Rl :\lYbllO^`jOlY57Y! %+)b l: +)/ ') '):8' 8b8bCIGOKTXVR[mfffjlnpfjsuywllO>lbYbl Yl bl YY)>lO8bJ HD)bl:)l % %+)b l )llY!l#(04*,%2.l :l ?y|DHJ XRVPTNL[^`\bjl O)w{y>uq`})g   HH&HHH&HHH22222&2&&@HHHHHHHH@& H&H &H&HHH&HH@@H&HHHH2222H222H22H22HHHHHHHHHHHHH222H@&@&&HHHHH`HH`HHHHH@@H@@HH @ HHHH HH HH HHHHH&HHHH HHH&H(HHHHHHH HHHHH&&&H&H@@2HHHHHHHH`HHHHHHHHHHHHHHHHHHH &HH&H&H HHHHHHHHHHHHHHHHHHH%'+,-.78=BPTXZ_`dmz!.567<?BFQbdhr #:J[emp}Oh+'0  D\h  @Windows Installer Intel;1033 "$&'()*3Yi|HR`222222    "$&(*,.02468:<>@BDF  !#%')+-/13579;=?ACE2222222222222222222222222222222222222222222222uuuuuuuuuuuuui9uuefddd uJiuuuuN߀eN'#'aaaaaaaaaaaaaaaaaaaaaa22JJ22JJ2OkkkVVk2kzOckkk22JJ22JJ2OkkkkVV2Ockkkk22//22//2O////V//2/O_////| "$$$$$$&&'())))))**3YYiiii||||HHHHHHHRRRR```22/JJJJJ/J22/JJJJJ/J2MO/:kk/:kk/:kk/:kkkkkkV//VVrt/2/ {|~MMOO_ac/:kk/:kk/:kkkkk/:kkXXZuX]^`ZXXXZuX]^`ZXXXXZuXuZuXuZuXuZuXZuZZXXXZXZXXXXXXXXXXXXZuXuZuXuZuXZuZZZuXuWWY\W\\\YWWWY\W\\\YWWWYwWtYWYWYWWWWYWYWWzYWYWYWYWVVVVVV_V[[_VVqvsVVVVVVVVVVVVVVVVVVprprprprprSU    """"''''((((3333ii||||@HBExE(;2DD1BE6H/4@HB'C$H  :H99K8K9H::J9E9 9988 8:; H$B maximum ProductVersion of the products in this set. The set may or may not include products with this particular version.VersionMinThe minimum ProductVersion of the products in this set. The set may or may not include products with this particular version.VerbOptional value for the command arguments.CommandThe command text.Order within the verbs for a particular extension. Also used simply to specify the default verb.The verb for the command.TARGETDIRDefaultFeature_4605E268038140F18D4C296DFD527FF6{6101B0DB-BE0E-D804-3639-5DA8CA5EAFC4}C__4605E268038140F18D4C296DFD527FF6LICENSE.RTF|license.rtf_53FD8151F5CC4026A737BB25A1F8818D{1769E893-FCEF-0CC3-367E-EAEDE49569AE}C__53FD8151F5CC4026A737BB25A1F8818DPAPERCUT.HLP|PAPERCUT.HLP_A89FE3D326224D84BC65B83449AAC178{5DE8D8B5-CFAE-E298-56FA-9A2389304797}C__A89FE3D326224D84BC65B83449AAC178LICENSE.TXT|license.txt_ECA981F509B04CFC98FC93D5C02F0605{FD52C776-808D-4B5F-96B9-979BB77DE7E5}C__ECA981F509B04CFC98FC93D5C02F0605PAPERCUT.CNT|PaperCut.cnt_F82FD72C2E2748DEBD4AF24F5C2AA984{EB4F6FB9-2766-1AB7-EF34-5D489F23B60C}C__F82FD72C2E2748DEBD4AF24F5C2AA984README.TXT|ReadMe.txt_294823.exePapercut ShapePapercutShapeC__72D9D018A951C72DDD513808CF9E1FF4shpopen"%1"&Open.:USER'S~1|User's DesktopDesktopFolderSourceDir[ProgramFilesFolder]\[ProductName]DIRCA_TARGETDIRTARGETDIR="".:USER'S~2|User's Programs MenuProgramMenuFolderPAPERCUT|Papercut_841E8ABA17B043F9871174495562328F{18B376FA-3E10-4400-977F-C0A93CAD1BAA}C__746C69616E6711D38E0D00C04F6837D0_0609A501CF2845618360221A5774BA3EPapercutProductNameProductCode{2F752531-B659-420F-9699-7FA6C39A53C7}1.0.15ProductVersionHenry GrooverManufacturermailto:support@paper-model.comARPHELPLINKARPCONTACTPaperCut paper modellingARPCOMMENTShttp://paper-model.comARPURLINFOABOUT1033ProductLanguagePREVIOUSVERSIONSINSTALLED1.0.0.0SecureCustomPropertiesNEWERPRODUCTFOUNDPREVIOUSVERSIONSINSTALLED;NEWERPRODUCTFOUND[VSDVERSIONMSG]ERRCA_CANCELNEWERVERSIONNEWERPRODUCTFOUND AND NOT Installed[VSDUIANDADVERTISED]ERRCA_UIANDADVERTISEDProductState=1FindRelatedProductsNOT InstalledLaunchConditionsRMCCPSearchValidateProductIDCostInitializeFileCostRedirectedDllSupportIsolateComponentsCostFinalizeSetODBCFoldersInstallValidateInstallInitializeAllocateRegistrySpaceProcessComponentsMsiPublishAssembliesMsiUnpublishAssembliesUnpublishComponentsUnpublishFeaturesVersionNTStopServicesDeleteServicesUnregisterComPlusSelfUnregModulesUnregisterTypeLibrariesRemoveODBCUnregisterFontsRemoveRegistryValuesUnregisterClassInfoUnregisterExtensionInfoUnregisterProgIdInfoUnregisterMIMEInfoRemoveIniValuesRemoveShortcutsRemoveEnvironmentStringsRemoveDuplicateFilesRemoveFilesRemoveFoldersCreateFoldersMoveFilesInstallFilesPatchFilesDuplicateFilesCreateShortcutsRegisterClassInfoRegisterExtensionInfoRegisterProgIdInfoRegisterMIMEInfoWriteRegistryValuesWriteIniValuesWriteEnvironmentStringsRegisterFontsInstallODBCRegisterTypeLibrariesSelfRegModulesRegisterComPlusInstallServicesStartServicesRegisterUserRegisterProductPublishComponentsPublishFeaturesPublishProductInstallFinalizeRemoveExistingProductsInstallAdminPackageExecuteAction_18be6784.exePapercut paper modelling_36DC272B22964F4CA19625DB924F6B71_4ae13d6c.exeRELEAS~1.TXT|Release notes (readme.txt)_3D8464F36C2A4577BA5DDD21B36AF409VsdBase.B242FD8F_28D6_4590_A991_07971DF894FBThis setup requires the .NET Framework version [1]. Please install the .NET Framework and run this setup again. The .NET Framework can be obtained from the web. Would you like to do this now?VSDNETURLMSGThis setup requires Internet Information Server 4.0 or higher and Windows NT 4.0, Windows 2000, or Windows XP. This setup cannot be installed on Windows 95, Windows 98, or Windows Me. Please install Internet Information Server and run this setup again.VSDIISMSGThis advertised application will not be installed because it might be unsafe. Contact your administrator to change the installation user interface option of the package to basic.VSDUIANDADVERTISEDThis setup requires the .NET Framework version [1]. Please install the .NET Framework and run this setup again.VSDNETMSGThe specified path '[2]' is unavailable. The Internet Information Server might not be running or the path exists and is redirected to another machine. Please check the status of this virtual directory in the Internet Services Manager.VSDINVALIDURLMSGUnable to install because a newer version of this product is already installed.VSDVERSIONMSGUserExitFormNOT HideFatalErrorFormFatalErrorFormInstalled<>""MaintenanceFormInstalled="" AND RESUMEResumeFormAdminUserExitFormAdminFatalErrorFormAdminMaintenanceFormAdminResumeFormVsdDialogs.83D22742_1B79_46f6_9A99_DF0F2BD4C077RepairAdminMaintenanceForm_Action|CancelButton{\VSI_MS_Sans_Serif13.0_0_0}&ClosePushButtonCloseButtonAdminFinishedForm{\VSI_MS_Sans_Serif13.0_0_0}MsiHorizontalLineLineLine1Line2BannerBmp{\VSI_MS_Sans_Serif13.0_0_0}< &BackPreviousButton{\VSI_MS_Sans_Serif13.0_0_0}CancelDefBannerBitmapBitmap{\VSI_MS_Sans_Serif16.0_1_0}Installation CompleteBannerText{\VSI_MS_Sans_Serif13.0_0_0}A network image of [ProductName] has been successfully created. Click "Close" to exit.BodyTextInstall{\VSI_MS_Sans_Serif13.0_0_0}[ProductName] has been successfully removed. Click "Close" to exit.BodyText{\VSI_MS_Sans_Serif16.0_1_0}Installation Interrupted{\VSI_MS_Sans_Serif13.0_0_0}The installation was interrupted before [ProductName] could be installed. You need to restart the installer to try again.{\VSI_MS_Sans_Serif13.0_0_0}The installer was interrupted before [ProductName] could be removed. You need to restart the installer to try again. Click "Close" to exit.BodyTextRemove{\VSI_MS_Sans_Serif16.0_1_0}Installation Incomplete{\VSI_MS_Sans_Serif13.0_0_0}The installer was interrupted before [ProductName] could be installed. You need to restart the installer to try again. Click "Close" to exit.FinishButton{\VSI_MS_Sans_Serif16.0_1_0}Welcome to the [ProductName] Setup Wizard{\VSI_MS_Sans_Serif13.0_0_0}Select whether you want to repair or remove [ProductName].RepairRadioGroup{\VSI_MS_Sans_Serif13.0_0_0}&Finish{\VSI_MS_Sans_Serif13.0_0_0}MsiRadioButtonGroupRadioButtonGroup{\VSI_MS_Sans_Serif13.0_0_0}The installer will resume the installation of [ProductName] on your computer. Click "Finish" to continue.REMOVE=""ShowREMOVE<>""Hide1ReturnEndDialogCancelSpawnDialogAdminMaintenanceForm_Action="Repair"ALL[REINSTALL]ReinstallAdminMaintenanceForm_Action="Remove"[REMOVE][ProductName]{\VSI_MS_Sans_Serif13.0_0_0}&Repair [ProductName]{\VSI_MS_Sans_Serif13.0_0_0}Re&move [ProductName]MS Sans SerifVSI_MS_Sans_Serif13.0_0_0VSI_MS_Sans_Serif16.0_1_0_02F9A4205834EE7EE06C934BB76A00FBVsdDialogs.6DBC9783_3677_4D68_8BF5_D749558A0AC1ConfirmInstallForm{\VSI_MS_Sans_Serif13.0_0_0}&Next >NextButton{\VSI_MS_Sans_Serif16.0_1_0}Confirm Installation{\VSI_MS_Sans_Serif13.0_0_0}The installer is ready to install [ProductName] on your computer. Click "Next" to start the installation.BodyText1ConfirmInstallForm_PrevArgs=""DisableConfirmInstallForm_PrevArgs<>""EnableConfirmInstallForm_NextArgs<>""[ConfirmInstallForm_NextArgs]NewDialogConfirmInstallForm_NextArgs=""[ConfirmInstallForm_PrevArgs]_177323C84FE62F322C1ECB5526A6DD9FVsdDialogs.8FA7D956_B864_4FF4_92F0_FB2799B33176NoEulaForm_PropertyEulaFormAgreeRadioGroup{\rtf1\ansi\ansicpg1252\uc1\deff0\stshfdbch0\stshfloch0\stshfhich0\stshfbi0\deflang1033\deflangfe1033{\fonttbl{\f0\froman\fcharset0\fprq2{\*\panose 02020603050405020304}Times New Roman;} {\f2\fmodern\fcharset0\fprq1{\*\panose 02070309020205020404}Courier New;}{\f266\froman\fcharset238\fprq2 Times New Roman CE;}{\f267\froman\fcharset204\fprq2 Times New Roman Cyr;}{\f269\froman\fcharset161\fprq2 Times New Roman Greek;} {\f270\froman\fcharset162\fprq2 Times New Roman Tur;}{\f271\froman\fcharset177\fprq2 Times New Roman (Hebrew);}{\f272\froman\fcharset178\fprq2 Times New Roman (Arabic);}{\f273\froman\fcharset186\fprq2 Times New Roman Baltic;} {\f274\froman\fcharset163\fprq2 Times New Roman (Vietnamese);}{\f286\fmodern\fcharset238\fprq1 Courier New CE;}{\f287\fmodern\fcharset204\fprq1 Courier New Cyr;}{\f289\fmodern\fcharset161\fprq1 Courier New Greek;} {\f290\fmodern\fcharset162\fprq1 Courier New Tur;}{\f291\fmodern\fcharset177\fprq1 Courier New (Hebrew);}{\f292\fmodern\fcharset178\fprq1 Courier New (Arabic);}{\f293\fmodern\fcharset186\fprq1 Courier New Baltic;} {\f294\fmodern\fcharset163\fprq1 Courier New (Vietnamese);}}{\colortbl;\red0\green0\blue0;\red0\green0\blue255;\red0\green255\blue255;\red0\green255\blue0;\red255\green0\blue255;\red255\green0\blue0;\red255\green255\blue0;\red255\green255\blue255; \red0\green0\blue128;\red0\green128\blue128;\red0\green128\blue0;\red128\green0\blue128;\red128\green0\blue0;\red128\green128\blue0;\red128\green128\blue128;\red192\green192\blue192;}{\stylesheet{ \ql \li0\ri0\widctlpar\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0 \fs24\lang1033\langfe1033\cgrid\langnp1033\langfenp1033 \snext0 Normal;}{\*\cs10 \additive \ssemihidden Default Paragraph Font;}{\* \ts11\tsrowd\trftsWidthB3\trpaddl108\trpaddr108\trpaddfl3\trpaddft3\trpaddfb3\trpaddfr3\trcbpat1\trcfpat1\tscellwidthfts0\tsvertalt\tsbrdrt\tsbrdrl\tsbrdrb\tsbrdrr\tsbrdrdgl\tsbrdrdgr\tsbrdrh\tsbrdrv \ql \li0\ri0\widctlpar\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0 \fs20\lang1024\langfe1024\cgrid\langnp1024\langfenp1024 \snext11 \ssemihidden Normal Table;}{\s15\ql \li0\ri0\widctlpar\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0 \f2\fs20\lang1033\langfe1033\cgrid\langnp1033\langfenp1033 \sbasedon0 \snext15 Plain Text;}}{\*\latentstyles\lsdstimax156\lsdlockeddef0}{\*\rsidtbl \rsid546395\rsid1010787\rsid1198529\rsid2313807\rsid2692041\rsid2891666\rsid3086605\rsid3152711\rsid3620618 \rsid3876851\rsid4024144\rsid4851415\rs````AAGGAAGGAAGGAAGGAACC(( {{{{{{{{{{{{{{{𷷷p{{{{  x 2@HDDrDhD7H@HC/B@HArD ArDGB::8>B;Bp6id4930068\rsid5057144\rsid5529331\rsid5703300\rsid6515819\rsid6830067\rsid7555653\rsid7674014\rsid7734558\rsid8468340\rsid8739590\rsid8856977\rsid9641152\rsid9971380\rsid10560033\rsid11216091\rsid11862428 \rsid12469523\rsid12718684\rsid12923352\rsid12977608\rsid13522686\rsid14707424\rsid14770099\rsid14818175\rsid15170078\rsid15561001}{\*\generator Microsoft Word 11.0.6359;}{\info{\title Open Software License ("OSL") v}{\author Henry Groover} {\operator Henry Groover}{\creatim\yr2006\mo4\dy17\hr23\min10}{\revtim\yr2006\mo4\dy17\hr23\min10}{\version2}{\edmins1}{\nofpages3}{\nofwords1540}{\nofchars8781}{\*\company }{\nofcharsws10301}{\vern24703}}\margl1319\margr1319 \widowctrl\ftnbj\aenddoc\noxlattoyen\expshrtn\noultrlspc\dntblnsbdb\nospaceforul\formshade\horzdoc\dgmargin\dghspace180\dgvspace180\dghorigin1319\dgvorigin1440\dghshow1\dgvshow1 \jexpand\viewkind1\viewscale100\pgbrdrhead\pgbrdrfoot\splytwnine\ftnlytwnine\htmautsp\nolnhtadjtbl\useltbaln\alntblind\lytcalctblwd\lyttblrtgr\lnbrkrule\nobrkwrptbl\sna(( '{58554F30-49CF-4B97-9562-9C25C52F7532} Papercut$Paper modeling for geometric solidsHenrIntel;1033@ #h@ #h@HYEBA #o @HF7BED1H!n @HBuA m @H C5BErEB;B-6@HBrEAE 0ArDGAh8AA>B;B,6\pnlcltr\pnstart1\pnindent720\pnhang {\pntxtb (}{\pntxta )}}{\*\pnseclvl7\pnlcrm\pnstart1\pnindent720\pnhang {\pntxtb (}{\pntxta )}}{\*\pnseclvl8\pnlcltr\pnstart1\pnindent720\pnhang {\pntxtb (}{\pntxta )}}{\*\pnseclvl9\pnlcrm\pnstart1\pnindent720\pnhang {\pntxtb (}{\pntxta )}}\pard\plain \s15\ql \li0\ri0\widctlpar\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0\pararsid328856 \f2\fs20\lang1033\langfe1033\cgrid\langnp1033\langfenp1033 {\insrsid4851415\charrsid4851415 Open Software License ("OSL") v. 3.0 \par \par This Open Software License (the "License") applies to any original work of authorship (the "Original Work") whose owner (the "Licensor") has placed the following licensing notice adjacent to the copyright notice for the Original Work: \par \par Licensed under the Open Software License version 3.0 \par \par 1) Grant of Copyright License. Licensor grants You a worldwide, royalty-free, non-exclusive, sublicensable license, for the duration of the copyright, to do the following: \par \par a) to reproduce the Original Work in copies, either alone or as part of a collective work; \par \par b) to translate, adapt, alter, transform, modify, or arrange the Original Work, thereby creating derivative works ("Derivative Works") based upon the Original Work; \par \par c) to distribute or communicate copies of the Original Work and Derivative Works to the public, with the proviso that copies of Original Work or Derivative Works that You distribute or communicate shall be licensed under this OprprRTTRTRRTRTTRTRRTRTTRoqw-{HJL,z,HIKz   x܅ș<7X_  d̐ɀȀX Lx܅@jrlЇ4`ĉ(THt؎r\$P|D pԗ8ș  &(( @wwwwwwppppppppppppppppppppppxx?( www  &(( @0333330333 333 3 3 330 330 {w7/?( 303 0 er roe l ihsrs||i@HD'F/BCjDExE(H0f@HDED/H  @HDED/;rD'C7CrD._`@HDED;9BEMhpen Software License; \par \par d) to perform the Original Work publicly; and \par \par e) to display the Original Work publicly. \par \par 2) Grant of Patent License. Licensor grants You a worldwide, royalty-free, non-exclusive, sublicensable license, under patent claims owned or controlled by the Lic ensor that are embodied in the Original Work as furnished by the Licensor, for the duration of the patents, to make, use, sell, offer for sale, have made, and import the Original Work and Derivative Works. \par \par 3) Grant of Source Code License. The term "Sour ce Code" means the preferred form of the Original Work for making modifications to it and all available documentation describing how to modify the Original Work. Licensor agrees to provide a machine-readable copy of the Source Code of the Original Work al o ng with each copy of the Original Work that Licensor distributes. Licensor reserves the right to satisfy this obligation by placing a machine-readable copy of the Source Code in an iRTTRTRRTRTTRRTRTTRTRRTRTTR_`dmz!%)#' $(,;4< ^(a6P0Ȭ(8,--{{,uz\,uz\\VV\\bcbc|k@H CCB ?<@HA'C:ED1H@HBEEC(HF0@H C1A5G 1 $nformation repository reasonably calculated to permit inexpensive and con venient access by You for as long as Licensor continues to distribute the Original Work. \par \par 4) Exclusions From License Grant. Neither the names of Licensor, nor the names of any contributors to the Original Work, nor any of their trademarks or service marks , may be used to endorse or promote products derived from this Original Work without express prior permission of the Licensor. Except as expressly stated herein, nothing in this License grants any license to Licensor\rquote s trademarks, copyrights, patents, trad e secrets or any other intellectual property. No patent license is granted to make, use, sell, offer for sale, have made, or import embodiments of any patent claims other than the licensed claims defined in Section 2. No license is granted to the trademar k s of Licensor even if such marks are included in the Original Work. Nothing in this License shall be interpreted to prohibit Licensor from licensing under terms different from this License any Original Work that Licensor otherwise would have a right to li cense. \par \par 5) External Deployment. The term "External Deployment" means the use, distribution, or communication of the Original Work or Derivative Works in any way such that the Original Work or Derivative Works may be used by anyone other than You, whether those works are distributed or communicated to those persons or made available as an application intended for use over a network. As an express condition for the grants of license hereunder, You must treat any External Deployment by You of the Original Wo rk or a Derivative Work as a distribution under section 1(c). \par \par 6) Attribution Rights. You must retain, in the Source Code of any Derivative Works that You create, all copyright, patent, or trademark notices from the Source Code of the Original Work, as we ll as any notices of licensing and any descriptive text identified therein as an "Attribution Notice." You must cause the Souk    '()*3#% ,z,HIKz\,u7_  "$&!#%dX +#'2222uu#'*"&+hyG uuuuuuuuuuuuu)!%aaaaaaaaaaaaaaaa  kk2k22JJ22JJ2kkkk222//22//2/////2//:kkkkkk/2XX "$$$$$$&&'())))))**3iiii||||22/JJJJJ/J22/JJJJJ/J2/:kk/:kk/:kk/:kkkkkk/2/XXZuX]^`ZXXXZuX]^`ZXXZuXuZuXuZuXuZuXZuZZZXZWWY\W\\\YWWWY\W\\\YWWYwWtYWYWYWYWYVVVVVV_V[[_VVqvsVVVVVVV    """"''''((((3333ii||||AAGGAAGGAAGGAAGGAACC::::kk::::CCGGSUSUSUSUSUSUSUSUSUSUprprprprprSUSUSUSUSUSUSUSUSU C1A5GG8O: 98:9;;8;8:9:8:*' C1A5GG988 :;9;8;;:E999M;;*4@HNFhD=D3CB C1A5GG9:88;B;8 89B::L:;C989*( C1A5GGJ:;;: 8N;;G;:@;::A;:9;*%* C1A5GGD8: ;8;8;;O988O99;99* C1A5GG:F8C;;:C8 8@9A899:8H: 8 9*` @H<BE  @rce Code for any Derivative Works that You create to carry a prominent Attribution Notice reasonably calculated to inform recipien ts that You have modified the Original Work. \par \par 7) Warranty of Provenance and Disclaimer of Warranty. Licensor warrants that the copyright in and to the Original Work and the patent rights granted herein by Licensor are owned by the Licensor or are sublicen sed to You under the terms of this License with the permission of the contributor(s) of those copyrights and patent rights. Except as expressly stated in the immediately preceding sentence, the Original Work is provided under this License on an "AS IS" BA S IS and WITHOUT WARRANTY, either express or implied, including, without limitation, the warranties of non-infringement, merchantability or fitness for a particular purpose. THE ENTIRE RISK AS TO THE QUALITY OF THE ORIGINAL WORK IS WITH YOU. This DISCLAIMER OF WARRANTY constitutes an essential part of this License. No license to the Original Work is granted by this License except under this disclaimer. \par \par 8) Limitation of Liability. Under no circumstances and under no legal theory, whether in tort (including negligence), contract, or otherwise, shall the Licensor be liable to anyone for any indirect, special, incidental, or consequential damages of any character arising as a result of this License or the use of the Original Work including, without limitation, damages for loss of goodwill, work stoppage, computer failure or malfunction, or any and all other commercial damages or losses. This limitation of liability shall not apply to the extent applicable law prohibits such limitation. \par \par 9) Acceptance and Termi nation. If, at any time, You expressly assented to this License, that assent indicates your clear and irrevocable acceptance of this License and all of its terms and conditions. If You distribute or communicate copies of the Original Work or a Derivative W ork, You must make a reasonable effort under the circumstances to obtain the express assent of recipients to the terms of this License. This License conditions your rights to undertake the activities listed in Section 1, including your right to create Der ivative Works based upon the Original Work, and doing so without honoring these terms and conditions is prohibited by copyright law and international treaty. Nothing in this License is intended to affect copyright exceptions and limitations (including \'93fair use\'94 or \'93fair dealing\'94). This License shall terminate immediately and You may no longer exercise any of the rights granted to You by this License upon your failure to honor the conditions in Section 1(c). \par \par 10) Termination for Patent Action. This License shall terminate automatically and You may no longer exercise any of the rights granted to You by this License as of the date You commence an action, including a cross-claim or counterclaim, against Licensor or any licensee alleging that the Original Work infringes a patent. This termination provision shall not apply for an action alleging patent infringement by combinations of the Original Work with other software or hardware. \par \par 11) Jurisdiction, Venue and Governing Law. Any action or suit relating to thi s License may be brought only in the courts of a jurisdiction wherein the Licensor resides or in which Licensor conducts its primary business, and under the laws of that jurisdiction excluding its conflict-of-law provisions. The application of the United N ations Convention on Contracts for the International Sale of Goods is expressly excluded. Any use of the Original Work outside the scope of this License or after its termination shall be subject to the requirements and penalties of copyright or patent law in the appropriate jurisdiction. This section shall survive the termination of this License. \par \par 12) Attorneys\rquote Fees. In any action to enforce the terms of this License or seeking damages relating thereto, the prevailing party shall be entitled to recover i ts costs and expenses, including, without limitation, reasonable attorneys' fees and costs incurred in connection with such action, including any appeal of such action. This section shall survive the termination of this License. \par \par 13) Miscellaneous. If any provision of this License is held to be unenforceable, such provision shall be reformed only to the extent necessary to make it enforceable. \par \par 14) Definition of "You" in This License. "You" throughout this License, whether in upper or lower case, means an individual or a legal entity exercising rights under, and complying with all of the terms of, this License. For legal entities, "You" includes any entity that controls, is controlled by, or is under common control with you. For purposes of this definit i on, "control" means (i) the power, direct or indirect, to cause the direction or management of such entity, whether by contract or otherwise, or (ii) ownership of fifty percent (50%) or more of the outstanding shares, or (iii) beneficial ownership of such entity. \par \par 15) Right to Use. You may use the Original Work in all ways not otherwise restricted or conditioned by this License or by law, and Licensor promises not to interfere with or be responsible for such uses by You. \par \par 16) Modification of This Licens}{\insrsid3876851 e. This License is Copyright \'a9 }{\insrsid4851415\charrsid4851415 2005 Lawrence Rosen. Permission is granted to copy, distribute, or communicate this License without modification. Nothing in this License permits You to modify this License as applied to the Original Work or to Derivative Work s. However, You may modify the text of this License and copy, distribute or communicate your modified version (the "Modified License") and apply it to other original works of authorship subject to the following conditions: (i) You may not indicate in any w ay that your Modified License is the "Open Software License" or "OSL" and you may not use those names in the name of your Modified License; (ii) You must replace the notice specified in the first paragraph above with the notice "Licensed under " or with a notice of your own that is not confusingly similar to the notice in this License; and (iii) You may not claim that your original works are open source software unless your Modified License has been approved by Open Source In itiative (OSI) and You comply with its license review and certification process.}{\insrsid4851415 \par }}ScrollableTextLicenseText{\VSI_MS_Sans_Serif16.0_1_0}License Agreement{\VSI_MS_Sans_Serif13.0_0_0}Please take a moment to read the license agreement now. If you accept the terms below, click "I Agree", then "Next". Otherwise click "Cancel".EulaForm_Property<>"Yes"EulaForm_Property="Yes"EulaForm_PrevArgs=""EulaForm_PrevArgs<>""EulaForm_NextArgs<>""[EulaForm_NextArgs]EulaForm_NextArgs=""[EulaForm_PrevArgs]EnabledEulaEvent{\VSI_MS_Sans_Serif13.0_0_0}I &Do Not Agree{\VSI_MS_Sans_Serif13.0_0_0}I &AgreeYes_E61812B35E2D63B01729E8C92F35F214VsdDialogs.68F69290_BB7C_474E_A153_6679845F3DDFWelcomeForm{\VSI_MS_Sans_Serif13.0_0_0}This is open source free software. Please refer to the license agreement for details.CopyrightWarningText{\VSI_MS_Sans_Serif13.0_0_0}The installer will guide you through the steps required to install [ProductName] on your computer.WelcomeTextWelcomeForm_PrevArgs=""WelcomeForm_PrevArgs<>""WelcomeForm_NextArgs<>""[WelcomeForm_NextArgs]WelcomeForm_NextArgs=""[WelcomeForm_PrevArgs]_A95E9E48D0ED9F7D6A0D184B1D58472EVsdDialogs.C113BC36_2532_4D45_8099_4818B1133B2FMEFolderForm_AllUsersFolderFormFolderLabelAllUsersRadioGroup{\VSI_MS_Sans_Serif13.0_0_0}&Disk Cost...DiskCostButtonBrowseButton{\VSI_MS_Sans_Serif13.0_0_0}MsiPathEditPathEditFolderEdit{\VSI_MS_Sans_Serif13.0_0_0}&Folder:{\VSI_MS_Sans_Serif13.0_0_0}B&rowse...{\VSI_MS_Sans_Serif16.0_1_0}Select Installation Folder{\VSI_MS_Sans_Serif13.0_0_0}The installer will install [ProductName] to the following folder. To install in this folder, click "Next". To install to a different folder, enter it below or click "Browse".Body{\VSI_MS_Shell_Dlg13.0_0_0}Install [ProductName] for yourself, or for anyone who uses this computer:AllUsersTextVersionNT>=400 AND Privileged=1NOT (VersionNT>=400 AND Privileged=1)FolderForm_PrevArgs=""FolderForm_PrevArgs<>""DoActionSetTargetPathOutOfDiskSpace=1DiskCostFolderForm_NextArgs<>"" AND OutOfDiskSpace<>1[FolderForm_NextArgs]FolderForm_NextArgs="" AND OutOfDiskSpace<>1FolderForm_AllUsers="ALL"2[ALLUSERS]SelectFolderDialog[SelectFolderDialog_Property][FolderForm_PrevArgs]{\VSI_MS_Sans_Serif13.0_0_0}&Everyone{\VSI_MS_Sans_Serif13.0_0_0}Just &meMS Shell DlgVSI_MS_Shell_Dlg13.0_0_0VsdDialogs.EE9A1AFA_41DD_4514_B727_DF0ACA1D7389AdminProgressForm{\VSI_MS_Sans_Serif13.0_0_0}MsiProgressBarProgressBar{\VSI_MS_Sans_Serif13.0_0_0}Please wait...ProgressLabel{\VSI_MS_Sans_Serif13.0_0_0}[ProductName] is being installed.InstalledBody{\VSI_MS_Sans_Serif13.0_0_0}[ProductName] is being removed.RemovedBody{\VSI_MS_Sans_Serif16.0_1_0}Removing [ProductName]RemoveBannerText{\VSI_MS_Sans_Serif16.0_1_0}Installing [ProductName]InstalledBannerTextProgressUnmoveFilesSetProgress_41AAAC124FA3CEEEF570F0F5748F16B7VsdDialogs.1DB77F5A_BA5C_4470_89B6_0B0EC07E3A10MaintenanceForm_ActionFinishedForm{\VSI_MS_Sans_Serif13.0_0_0}UpdateText{\VSI_MS_Sans_Serif13.0_0_0}[ProductName] has been successfully installed. Click "Close" to exit.MaintenanceForm_Action="Repair"MaintenanceForm_Action="Remove"_BB613D6E5B31A00511C6560B0389D0A4VsdDialogs.4FB12620_0D15_42D0_8677_2766FFA6923FProgressFormVsdUserInterface.524F4245_5254_5341_4C45_534153783400VsdDefaultUIFont.524F4245_5254_5341_4C45_534153783400DefaultUIFontWill be installed on local hard driveMenuLocalThis feature frees up [1] on your hard drive. It has [2] of [3] subfeatures selected. The subfeatures free up [4] on your hard drive.SelParentCostNegNegThis feature will remain to be run from the networkSelNetworkNetworkThis feature will change from run from network state to be installed on the local hard driveSelNetworkLocalThis feature will change from run from network state to set to be installed when requiredSelNetworkAdvertiseThis feature will be uninstalled completely, you won't be able to run it from the networkSelNetworkAbsentThis feature will remain uninstalledSelAbsentAbsentGathering required information...ScriptInProgressWill be installed to run from CDMenuCDThis feature frees up [1] on your hard drive.SelChildCostNegThis feature will change from run from CD state to be installed on the local hard driveSelCDLocalEntire feature will be unavailableMenuAbsentThis feature will change from run from CD state to set to be installed when requiredSelCDAdvertiseEntire feature will be installed to run from networkMenuAllNetworkThis feature will be removed from your local hard drive, but will be still available to run from the networkSelLocalNetworkThis feature will be available to run from the networkSelAdvertiseNetworkEntire feature will be installed on local hard driveMenuAllLocalThis feature will be installed on your local hard driveSelAdvertiseLocalEntire feature will be installed to run from CDMenuAllCDThis feature will be uninstalled completely, you won't be able to run it from CDSelCDAbsentFeature will be installed when requiredMenuAdvertiseThis feature will be available to run from CDSelAdvertiseCDbytesWill be installed when requiredSelAdvertiseAdvertiseAbsentPathMBThis feature will become unavailableSelAdvertiseAbsentKBGBThis feature will be installed to run from the networkSelAbsentNetworkThis feature will be installed to run from CDSelAbsentCDThis feature will be set to be installed when requiredSelAbsentAdvertiseThis feature will be installed on the local hard driveSelAbsentLocalThis feature will remain to be run from CDSelCDCDFolder|New FolderNewFolderWill be installed to run from networkMenuNetworkThis feature will be removed from your local hard drive, but will be still available to run from CDSelLocalCDThis feature will be completely removedSelLocalAbsentCompiling cost for this feature...SelCostPendingThis feature will remain on you local hard driveSelLocalLocalThis feature requires [1] on your hard drive.SelChildCostPosThis feature will be removed from your local hard drive, but will be set to be installed when requiredSelLocalAdvertiseThis feature frees up [1] on your hard drive. It has [2] of [3] subfeatures selected. The subfeatures require [4] on your hard drive.SelParentCostNegPosThis feature requires [1] on your hard drive. It has [2] of [3] subfeatures selected. The subfeatures free up [4] on your hard drive.SelParentCostPosNegThis feature requires [1] on your hard drive. It has [2] of [3] subfeatures selected. The subfeatures require [4] on your hard drive.SelParentCostPosPosTime remaining: {[1] minutes }{[2] seconds}TimeRemainingAvailableVolumeCostAvailableDifferenceVolumeCostDifferenceRequiredVolumeCostRequiredDisk SizeVolumeCostSizeVolumeVolumeCostVolumeVsdDialogs.CE4B864F_F1C1_4B85_98D4_2A2BF5FFB12BErrorDialogUpFldrBtnSFF_UpFldrBtnNewFldrBtnSFF_NewFldrBtnYesButton{\VSI_MS_Sans_Serif13.0_0_0}&NoNoButton{\VSI_MS_Sans_Serif13.0_0_0}&Yes{\VSI_MS_Sans_Serif13.0_0_0}The installation is not yet complete. Are you sure you want to exit?ConfirmRemoveDialog{\VSI_MS_Sans_Serif13.0_0_0}You have chosen to remove [ProductName] from your computer. Are you sure you want to remove it?VolumeCostList1{\VSI_MS_Sans_Serif13.0_0_0}OKOKButton{\VSI_MS_Sans_Serif13.0_0_0}{116}{80}{80}{80}{80}VolumeCostList{\VSI_MS_Sans_Serif13.0_0_0}The list below includes the drives you can install [ProductName] to, along with each drive's available and required disk space.AvailableBodyText{\VSI_MS_Sans_Serif13.0_0_0}The amount of required disk space exceeds the amount of available disk space. The highlighted items indicate the drives with insufficient disk space.RequiredBodyTextListFilesInUse{\VSI_MS_Sans_Serif13.0_0_0}E&xit InstallationExitButtonFilesInUseContinueButton{\VSI_MS_Sans_Serif13.0_0_0}&Try AgainRetryButton{\VSI_MS_Sans_Serif13.0_0_0}&Continue{\VSI_MS_Sans_Serif13.0_0_0}MsiFilesInUseFileInUseProcess{\VSI_MS_Sans_Serif13.0_0_0}The following applications are using files which the installer must update. You can either close the applications and click "Try Again", or click "Continue" so that the installer continues the installation, and replaces these files when your system restarts.InstallBodyText{\VSI_MS_Sans_Serif13.0_0_0}The following applications are using files which the installer must remove. You can either close the applications and click "Try Again", or click "Continue" so that the installer continues the installation, and replaces these files when your system restarts.RemoveBodyTextBrowseTextFolderText{\VSI_MS_Sans_Serif13.0_0_0}MsiDirectoryListSelectFolderDialog_PropertyDirectoryListFolderList[SFF_NewFldrBtn]NewFolderButton[SFF_UpFldrBtn]FolderUpButtonFolderPathEdit{\VSI_MS_Sans_Serif13.0_0_0}MsiDirectoryComboDirectoryComboFolderCombo{\VSI_MS_Sans_Serif13.0_0_0}&Browse:ErrorTextAC{\VSI_MS_Sans_Serif13.0_0_0}C&ontinueIOROutOfDiskSpace<>1Exit[WelcomeForm_ConfirmRemove]RetryIgnore{}ResetDirectoryListNewDirectoryListUpErrorYesErrorAbortErrorCancelErrorIgnoreErrorNoErrorOkErrorRetryRemove [ProductName][ProductName] Disk Space[ProductName] Files in UseBrowse for FolderVsdDialogs.E35A0E2C_F131_4B57_B946_59A1A2A8F45FAdminWelcomeForm{\VSI_MS_Sans_Serif16.0_1_0}Welcome to the [ProductName] Network Setup Wizard{\VSI_MS_Sans_Serif13.0_0_0}WARNING: This computer program is protected by copyright law and international treaties. Unauthorized duplication or distribution of this program, or any portion of it, may result in severe civil or criminal penalties, and will be prosecuted to the maximum extent possible under the law.AdminWelcomeForm_PrevArgs=""AdminWelcomeForm_PrevArgs<>""Installed="" AND NOT RESUMEInstalled<>"" OR RESUMEAdminWelcomeForm_NextArgs<>""[AdminWelcomeForm_NextArgs]AdminWelcomeForm_NextArgs=""[AdminWelcomeForm_PrevArgs]VsdDialogs.836CEFDB_3154_4E4C_84F8_DC115871E5E1AdminEulaForm_PropertyAdminEulaFormAdminEulaForm_Property<>"Yes"AdminEulaForm_Property="Yes"AdminEulaForm_PrevArgs=""AdminEulaForm_PrevArgs<>""AdminEulaForm_NextArgs<>""[AdminEulaForm_NextArgs]AdminEulaForm_NextArgs=""[AdminEulaForm_PrevArgs]VsdDialogs.2DED2424_5429_4616_A1AD_4D62837C2ADAAdminFolderForm{\VSI_MS_Sans_Serif16.0_1_0}Network Location{\VSI_MS_Sans_Serif13.0_0_0}The installer will create a network image at the following location. To create an image in this folder, click "Next". To use a different folder, enter it below or click "Browse".AdminFolderForm_PrevArgs=""AdminFolderForm_PrevArgs<>""AdminFolderForm_NextArgs<>"" AND OutOfDiskSpace<>1[AdminFolderForm_NextArgs]AdminFolderForm_NextArgs="" AND OutOfDiskSpace<>1AdminFolderForm_AllUsers="ALL"[AdminFolderForm_PrevArgs]VsdDialogs.FA58E60A_A1E8_4876_95FC_2AC3B5AAA5F8AdminConfirmInstallFormAdminConfirmInstallForm_PrevArgs=""AdminConfirmInstallForm_PrevArgs<>""AdminConfirmInstallForm_NextArgs<>""[AdminConfirmInstallForm_NextArgs]AdminConfirmInstallForm_NextArgs=""[AdminConfirmInstallForm_PrevArgs]WelcomeForm_NextArgsEulaForm_PrevArgsEulaForm_NextArgsFolderForm_PrevArgsFolderForm_NextArgsConfirmInstallForm_PrevArgsAdminWelcomeForm_NextArgsAdminEulaForm_PrevArgsAdminEulaForm_NextArgsAdminFolderForm_PrevArgsAdminFolderForm_NextArgsAdminConfirmInstallForm_PrevArgs1.0VC_User_CRT71.07D8793C_DC93_47EF_8FDA_3517BC941A0FVC_User_MFC71.211ADFCA_ED54_4E97_A0C1_80845B72BE777.10.3052.4CRT71_Customer_Redist_____X86.3643236F_FC70_11D3_A536_0090278A1BB8FL_msvcr71_dll_3_____X86.3643236F_FC70_11D3_A536_0090278A1BB8{FFEA2FF0-EE54-4A0A-A8B4-331C79B30649}HelpFileToNamespaceHelpFile_HelpNamespace_HelpFileHelpFileKeyHelpFileNameLangIDFile_HxSFile_HxIFile_HxQFile_HxRFile_SamplesHelpFilterFilterKeyQueryStringHelpFilterToNamespaceHelpFilter_HelpPluginHelpNamespace_ParentFile_HxTFile_HxAFile_ParentHxTHelpNamespaceNamespaceKeyNamespaceNameFile_CollectionAction to insertModuleAdminExecuteSequenceBefore (0) or After (1)AfterBase action to determine insert location.BaseActionStandard Sequence numberTable name to ignore during merge operation.ModuleIgnoreTableModuleAdminUISequenceModuleAdvtExecuteSequenceModuleAdvtUISequenceModuleInstallExecuteSequenceModuleInstallUISequenceForeign key into HelpFile table (required).Foreign key into HelpNamespace table (required).Primary Key for HelpFile Table (required).Key for HxS (Title) file (required).Key for HxI (Index) file (optional).Internal Microsoft Help ID for this HelpFile (required).Language ID for content file (optional).Key for HxR (Attributes) file (optional).Key for HxQ (Query) file (optional).Key for a file that is in the 'root' of the samples directory for this HelpFile (optional).Friendly name for Filter (required).Primary Key for HelpFilter (requiredSUSUSUSURTTRTRRTRTTRTRRTRTTRoqRTTRTRRTRTTRRTRTTRTRRT         """""""""$$$$$$$$$&&&&&&&&'''''''''((((((((()))))))))********333333333iiiiiiii||||||||||/2678:?AG/2678:?AG/678:?CJM/678:?CJ/2678:?AG/2678:?AG/678:?CJM/678:?CJ/2678:?AC/678:?kn/678:?Ck}/678:?k/678:?k/678:k/2678:?CG/678:k1155=11155=1155=11P155=111155=11155=1155=11P155=111155=1155=11155=11P155=11155=11P11155=111155=1155=11,  , , ,,  , , ,, , , , , ,  , ,  4 ??4 ??4 ?l4 ?4 ??4 ??4 ?l4 ?4 ??4 ?      !"#$%&'()*+,-./0123456abcdefghijklmnopqrstuvwxyz{|}~4 ?i4 ?4 rҀ~~?4l`?? 4 ??؀4l`?? BBwwwB2VbBBwwwB2bbBwwwB2bB\BwwJFIFddDucky<Adobed       F !1AQaq"2B#b$Rr3JFIFddDucky<Adobed       F !1AQa"q2#BRb3C$drTt5!1A"2qaQ# ?ڐC9}gOEW v8ʦ"TwmpiDj˔▓R7W_i˱}\ JMS-I?Z.ji#a,G*g\]88ZP=hI"dO, 0Q(D,ER;<e qHmJQDf=1[422fq6ml9DwGG*+q-mIL2$"IBtx cg_=Y y3QQmR'1xVWdǔk{vds]ns:fG\W VO%OW{Rqe[\r3"*ߠշ 6yV_um >i23*$8*ք^9pJ&c EO٤^p,ʸfTA-áNӈXaqtb3ˏdomsTMs=:|?^ϭ9IϺ5y%h" Tʫ nQWSM6Vf`w)RSem" SoMG%-nMKphB}ľ#+[#s2mTHP?f3KQǀqvno+PDFj?:SkA +h2RTP*-HC#!v(he.]ar#2;$6J&Zԓ%ȩ)mG]t##A]9kۯ1a܈7y/\ sRʉĤA#H2B)RcO֐Ԛ+t{mgPY-|kUR9[=Cn< )Y_/m9dGXp,02Ls/2}c]尸_)9!479 2mEcҬٵߧ.'}\^q1.UhJR_U$){hZmہǪi6DymmQ~dlڕSi:1ʋXlDWC-iN%k8eAinEE'{N52WNaE曌-VW2Xi)յ #. #k'-³}WZ '6&#R܄TPFeE$+1?tíȰ<5ekܔJ4ZSrME]1Q!fY$$J)2ej[K-e_ :Uϯq߼q҉fu1uSh.6 :2۳f9c3MeҖf+ ;h=lTy:Ҥ:^-nlvZ5-ndu$\j=Ǹw;#M$`z>ͳ?5m/r %?Lem ?ЫQWNKY%8"_oOiOcn.[TLu'aITTp·Pj}a.kuE4#q4G=EvE.˚FdN>tΣ=FJ{6Eal^qIm[!oA~%Zo׮+ V(EB&QEr^ԛ{+A8SyJ]Rhd)q[5Qp]׭FVM}hĘ_O).3f\ѼAdi5a4oKgtSN/0Ӓm55ETjtDͿ9|l2Kwޥbtm(n-yڭ o*Qq3[jk&<&GRیWZ )5:Uҫ}_tDOjY@fC?cf|ܛ"휇(DJLddRg#gZmt'3l#LD[twwkksmS\A.;L)'c>]jzj mlX՟Nޒո2Il@쟞LQ4-LW]}db}xR%mBNњ-0pmԤV1 vs+b_I$׈FzِK&gZJ;ŲdI;YW1*3-&EPt[nX$F1ͮYZTK1ږ]Z[thU[b?^Úm}.Q; L$hJ#IZpW JLN)1nVrU P>I:H[Q۷^ſ$!\s49ՈS1%R=FKe 1EE՘O+O6(UwCP<-6y ? i~3Krҭt:8NvVR5\$Rwsy~7kJ[>*u$;R]Nq'kǷCSc%!1AQaq"23 ? 6JJ*(b(Xd#{ܽ-j&!0(=oKUV["((QTu{Ϻl][c 4V1e~W/-Mmi[)L]R~ax#dlOj&8a3k?SۖFE,ۦ<Ӭj!Y D4>V?7IrtK=4N&C_P=66):FR$"כLF*WE{UQn\էRU4BG){n8"$1/#Vyd+:VcwWS{s}0͵{-ODJhT<ڶcF1*]Yx݆h2sɑj"rnHz k?9ũ.~ 7tϧ>N^;DV&}~6q;qqm{)k-atP_-EsǢHnWv/G-n֨ݭEE}W/hUTkN\+^U!P.#qYyf=-?hL]#.Z5+UJjgBb&x9C`ώ@%tG*Q 溜ʦL,荼yO#ݼdnCwuo\WvUu>81̰$9QXUӇEoU# {scC3y#K=+تUVNUbvE+?<{U).9_޹^ ׭y1~,ٳg?:r\*Hb޼&klb uTm\J}N&ΪYiv86e|wWF{ <٬N)uu^}V˻!v霾]-J_#q7ʿ~๻&ğ q"0EJ~#ubuldKzerO/Ju1w6[w㦚_-!S㍋^/';O[໚"_Wm^V\E#Xb9Q]QkQO='Øĵٯ~/++qɡLPNw;TMF8K [?}cޮFvӦOq'6v=xi}W .ڵں83])åH)d䯫8[5[SWY-%+aZZ}<;uHivSUN:1Kh/j ipT. sbK(c_<[9g%}->kZ25q@ δ}"Y&M=ѹ=Bvag^&w) ?z{Mձ[GZnϳSu"k]4>iy˷!empsܹjZ^ׯ /՝뉊#{z]-aEZ/|J;*O/w9[Kk#]O>_B|}sUo>6I~fG?jF/rexˋ{_ոޗ5վSݲ-oe0>֊Ϗޮ+GJE`oF/][whN*'?N}Go^%6nb}:[O 7QWEsh]nxo#7ñ9`gwU-1+m߾M7x!qZ׬l=q{g m I#G|Ozyd|wm[OHYu/Tw@(~c;y;1E4Q#}_lbOmmHw;WIrA#jlf]ˎز_-DpyY6ξTw_z¯T 6'FQvjS0]@-cmD'KUV~0_ IvZi0?5M8饯or""qٽٞS+]8K֎vqTm E7$Ҹ26 I%LC[˳m oZDn&*>>ZkL<:6Lj3[Gѱ<9 *W;ͫ1i:V̐V75H?ywV&%RMu421LquTqwv+֗2yuKykLᑣju)w~BͷgX5[#=lU:^~.O=7oGʺל83Y.Z Z 5%qq[zZ31I"~+mrB%3trMƘ9yx6w髈q'aEb>lUf}'^(-e|k!”3jDM'ݖN߹/4.>*0~BUcֆ+ yx$ 4_JPڗx`\ZMN#mޥ ~X yTNٷ zVgk\].;FA4x#&`Fwθ3)] 6Ɠ8L*ј֕q;ff%u2vNCah)_0Wm1*7gյc4 \>%ƀ 8ae6ug(m2Wkk\0+M/%nj&zrCyqm 1;&cGjK-?Fjۯ59lQ׋_XM#JwL? Vܽm::y[Atl&>8pwi_]M؏IZ_=u+\:ʦ3:;3]ZWt#NjvANJ-iOJEgIbq˅Py+<"b'aU<ҼMZ?[஛tFGK Y\]7% BFه2kU^YV͠{Ix`̾Bx62p2ѷ^ aaмcLJz;yM\GѺ)#pPGd9j%~&h:^7P2Vsj)JG֜Kt=\nRxU1Z,ɯwu+er_c@@'\Đ08£VUG9&Ss\63bllk*CA{vGf!s47RIy[G3 ,ap4$*1]V2n\f\V55ΚHݚ20(#=լD2{u[ ΧPzTښ6jMk[;~ 8(Bb|mxvvż,Vv4QA$~:hI[&[. J㔊O\Lxog'6s!q8hifq#QOfͯT6Y,"&i\$=h././veAi։{F]*qSǒa/`1\=?[MNӯ\]]0,pAV՘2Gbil[én=Vu3Qu>>D}ϟ26^c^Vڌ2F8Վ $ք.m\[Mg.1_w3Cy1^-1?Ӷ6V-,zYzm&Ff&IZ$,mvDB|NpZN 5}s07NXԄJ0"p!KdV" q!ƽ^k5{EgDۢNqgcn%$b]XUқ[[I[[]-# < /:{ܸ܆z2QZ h $ MɆWRr1YI]^јKZE2`52ߦ_+C$W2 F*L,{k|6ègt9l`81#>_bcr5D٘a~3CYzNUW2awuzԤkda1hҴm2rZlq-w Y6l{}nۯ>U qUՇ %E&zxͬ؎Sa^ooq>11>)z-hM ~eWkǕhh6VcYs0&hs>Zw+" ;6+hau"ж6\պ۫Hh$  } AU3x%[1≑9eŮg%s=S\Vxzܰ,KeysOk\?tfËR?z_ <]l{ƭ4ןXP Vrx[i.%> +T:,%!dfϦEH}uhugqā*2+&ݗwE^D I 01F n YXP{:ZӧWζν>CZkWMv'/xzKhǀ8b{)'~[]ջ,90(Mmʵ?/ cu+ .t1p-5 <({/_)eq3zMޞ-'Wh4aݏVGKZI']s(lle 3089j+>mnXsmE-ݛ`=F0b9,dR%>#;I?ZHR101.;]ޱpH4B1iNJmbZ4^k.gyi5ˠ"8ڸKţ,ZQIr2 j>=ofi; !0X,ӘX6' N !XvJp%#yS^#ϏùU3]pQnm繷lWPq_mVH];vK=g~q6u0w?,Emp-tsjnm/q MܶF+u_zJcxJ0*>$]xq("A@:0|sBcp**aܣ6VkopL;{+˭.ciR *g}AH+5g/V 7*;G[C,;C 8bqX6,Sk#i/y8VcpMl!JD;SM ]i E:swmb8]MkZ@!ǁ_ygf{csۘ&O֛{,b2.j\Hw{g19{b#=cդDG@:Go/z:%¾ڮQ-Ӟ[mfkp#殬Z^vYqdi*Y8M4s?r#2v=rqp②pg+~_6}CN"٭,R1^F=|{TTckqp W޼ߧ? f#l|{_1m#KId.xg@3Ajܟ8a8wׇbd^ݿ4s.hR'qIui[-29ozQ:!.`P{_wUN/UGwvZxò(5] cr*ð4dK8 4xØX,{XVW !yCN H4 յ9S-0"g;mFR3lS>ݵII?HӋX~Jw_?rt}19]>oJ-Y#B6jH>?9e$caʅz%g5'39m'96!K.alq fl:6,o"IQs%W*}}$OkH?vF{Lrֆز {+ m1<~WXܫRo=%5s>%z582_0d8ұ:ͼ S/ЇDaQU ZӍ[v8Fyia5,n,FNn2v>+^4ON%5Z޷T=Q<ӈ[+h6%omXִq~g쌋KͰOͷo7^tCJTП,6VOFx(,έ{3x^0 HNINϤެ"1D+}i _*';ĬQ-,.c}dn8[=!Wdu7WoCfT(L'qX.k7 d;Z3#3뽝5ư=?ɤ'{+UAC%](uWrY@B;44g9ljm;44x9jO~;449Kj;449jO;44<9j;0449>B;449j:/28:/28:J8M/:J8w-{,z,/:/28:/28:J8M/:J8/:/28:k8/:k8/}:JFIFddDucky<Adobed       F   !1Q"A2aBqRb#3$7rsтCD5&1!AQaq"2B#br3$4 ?~GBunUc$kU6ގRځ!ؘ$J A&걽JfOKWI-/a@հRH5o{ܿ[ 5r5rkx̂{;dlqct\UϩqGՒT˃.KvVWKsY+mܐ]L7EUNiF˶Jnkk>+hϊ vb([.zV q]J'SvvT[뻕Nhȓk)_Ny}84JG_3+bj︒GUU5"r fI- #;!sqM e{F+Q>D>ZDL1\N3 rFRH5o{ܿ[Q9emߚQDDjOkyiɮIs5\cm[1%_6WWb[^bcó:ÏMbEfvP[rHc?D9Y2VhHjBYUf%7$.FB੷S>\ĊZ?TG+l~n=yJciھaqL\ -I7$w w]"̜Rj9u;Dh/0M' ȞͷĭKGβu81c[)㻣,f`!v֒ȑ":7 ͧ/x&)I5_pyDXc|\9ֳ[SX7H9(**$ROP&l=۷NZM.]*YtQTja-kY yP7HbqW5^љ!~wlmn&Y\کÁqz,c8TxOgӽC̝ܝ5X1xT~kk>^HGK:HR#HG1Z:g*9_U_nTW{!'L-k"* tiU5S̜ʧk3OLX딗+Y+U[|Q >v,dނ-.Kݻ W,@"U|+CֱYO4Kvo&Iݧ+yG*%8S+dgzx,`7عfͬNRijiu^%/z"+jwhgwm< M*m6TJ5x Ykv$# 33Ě㫽dmJ.Қ5rU!R8|&ծ7f԰MgqVr5i'l}#X?G'v (yVuxdҵa V{R5⮲ɥtg;cLkQPjEbcX+|[ۊԒIr1QFU9g>^N*qvm_=AnK6SWU<_X_=ݎ8XW{v7L161se4+X 'I. gŠw?lDW]$~U=^5N&bsw/ڴsܯSWj{*{?ժE|;YZЬf׻C\SieX=3Wn if5u۪}5mo"9~Mٮo_&QaT.XVb#Utܤqj _+&k՝fcI+ecǪ+nk^Uj>p-b[ݤW 9\M0WjHZԭt5SU5rڍ,c=K9Ģ~Jxx epifO4j֤MohN ̿8<wps~_2@#R~ێFz6HrEV~RT"v޶b<'Rcɷ_k&cXlJOU-p뒼VӖ>mkZOʹhO|W>JFFjC0Ƒ62_t7hp3AB` 38m{&1o{5$z7otZ!?;nԢV6?> w?s=?Smt:77z7vO>#ݧ]G]ٯ Z寍LǙtݷ3~bՋl$ʱQ-D|=*{,㉿v_~Yɹonok)jC˶i31(پm\u:׻UZSVN1su]^KM_WoWٻw]~C-QKx.U$iV kkum9?.cX?ONMΑgޓVܮujƵR0k8/:k8/:k8/:/28:k8/..........................................................................................................................................................+hy JFIFddDucky<Adobed       F !1AQa"q2R#B3Sbs$5&6!1AQa"2b#qB ?RWr?#&ݘ'J1 s{B5u.C?a\RV|dƇ_o5LLϒӪP+3b'HqmJwNoY +K6'o]ȯZ*d/p{?^/gmhNJ`.IJn8'ZQ3XO/XcndzܷDeZc+Zi764On)=| "fG:0hȍ&DK1s'rnz̬R-_vpvU4mtG>McPk"[--|[<{^ߚӕF"#qyQ-~d\4_S wur*zVע|vnQf.+-KJmuj=}ji2'q=:<9mmJVpr!HW\m0I%^#w&}g{>Y+]Ofzj#dVg Y,6vz[D#_fLG6{ʳjչ)Z]֭DŽ\L뙉&n,7u'͕qJI&8Mܝ(ݻ \=v]zkmӞlE1<s,Yb"reMUZ#|;[ԯ]uuFXǴe+u |G׹-opPݢkڻDz8U6 $~.l/xwz4BW淫]ȫ1N%sG vj?2pt>giٍ7dӢo&VVuD)nZ]7/xP =V|;v'=V+|Xmoq\dƇe<ǙAܕ~ǥҐZ3xDDEf<|sS)b_]zQ)"/uceꇸ[n]r;?!= zͻ>O[:j8rK;w+n. QSTjZ vf"&dcݷ~;R~U&1˛z-;t_,|w?CImvGWw5jλJW]խkƧҾt:yc .XSɽ^sV泯 J-mv-18MIZv U]m8%ϓ|gG >n^n%ټliGӱHJӧQʾ:JNJkvi~) DWg^Ww.j%֥_6t?N)F[iљf깬bתc p~)b?H\y^-VԚűͮ?u6,lo;+{kS/l)??Fg5NRnRo_Sb"I9cn,;2Sh}쳯 CYS&8$En給M/9T˳r7-Meo1ok5{ yٕؕ>|yusN)}&sˏvѳK7S=ޮ5Me /wn9RRmN5fwiW6; gWJt%6f>_{Kls`72.ˎ1RaULZ8GVE4W Trz?P4k:*#CVSQׇe0ÇoiK="W8Μz:՛*Rϑ7Wiakx^z=1ю rψ*TΜ9jOegx C1A5G~;hB AqDhE C7DD C1A5G?;A:wDh> C1A5G=FCgEE1Hb>@HD'F/BDDrDhDE).Friendly name for Namespace (optional).Internal Microsoft Help ID for this Namespace (required).Primary Key for HelpNamespace (required).Key for HxC (Collection) file (required).MSVCR71.DLL|msvcr71.dllSHAPES|Shapes7.10.3077.0MFCu71_Customer_Redist_____X86.3643236F_FC70_11D3_A536_0090278A1BB8FL_mfc71u_dll_1_____X86.3643236F_FC70_11D3_A536_0090278A1BB8MFC71U.DLL|mfc71u.dllMFC71_Customer_Redist_____X86.3643236F_FC70_11D3_A536_0090278A1BB8FL_mfc71_dll_1_____X86.3643236F_FC70_11D3_A536_0090278A1BB8{3AC4AA25-A28A-4F09-826A-30CA0A620F35}{F607CA48-C332-4029-AF8A-39BDF6912CD4}MFC71.DLL|mfc71.dll_CA7708497044430D99DA983A754E881D_360EB74693B1E190380A3CE47870E082{07F92A16-B7B9-03D4-5F76-C4610F7B47ED}C__360EB74693B1E190380A3CE47870E082ESCHER~1.SHP|Eschers-solid.shp_9CD75DFFAEE11E5BDB7EDB2914B4678F{D88F2019-B2FB-395B-2E19-9F82D0D28FB8}C__9CD75DFFAEE11E5BDB7EDB2914B4678FRHOMBI~1.SHP|Rhombic-dodecahedron.shp_A21D171CEDFFB0124B053FC7A25D2E2F{BD0D0BEF-8ABD-8282-E47A-22A36F07541F}C__A21D171CEDFFB0124B053FC7A25D2E2FPAPERC~1.SHA|papercut.shapedef_72D9D018A951C72DDD513808CF9E1FF4{2FC2A6B6-5959-9836-A588-E10BE93A4FBD}1.0.0.296PAPERCUT.EXE|PaperCut.exe#_985C7B1B5898AA555C457E2D3C0FB4FB4o   ( ( 5  Oh  ;0R/XVie ' )? (*T# 2 -7 $       $6   TjB 4o   ( ( 5  Oh  ;0R/XVie ' )? (*T# 2 -7 $  + {sn  >t\F'; M.K"d 5== 8f86 Dd7T %; S .:^N|Q B s/[ q. ) re C b+94 s8$/C@ K6R ,R/Q: k>9.!v9s c%?J A   ?  O#3j S4!  J3A+*HH {r ns J ' L5f7  67 # 9 +" =  , "  ##10# ybAE ] X q L<=3 M0 ? H-     -;  , ! 9,7 564 *" 5$ + . 8 :^ &W M ]-81$ e>0 `[#  <z5ra_n?  Gr $ 4h5M l> I  D ? W#P ,Vp4:E N  +/  %   !,u!_Q 'Ms8 E $&  &  @ }g p\k%3$8#`` ; ~ ~ )` !&#!&#!&#!&#!&#  #  " !&#!  &     +#                  ! '!,  p O     / I" S $-(( (#@" 1 ub43 EV#/   # $  $ 11 !/# A0    !/; - +$!/ q~ !/ # ) ' $&6d % -, %$ /#* * = ; 24  !/  d!/ #55 % 3\YY$! -W " T4l64 7/ P ' - $6- 66* % c '"0 -f+    /      `{ 1.  & %)  ,  - $ %    /M;/ /,21/#$$"#" 22 B=&           ) ,+0*$$8%%%'''+++,,,---.......7788=========BBBBPPPPPPPPTTXXZZZZZZZZ_``dddddddddddddmmmmmmzz!!!!!!!!......55566677<<????BBBBBFFFFFQQQQQQbbbdddhhhhhrrrrrr     #############::::::::::::JJJJJJJJJ[[[[[eeeeeeeemmppppppp}}}}}  # ')'O ') ') ')./123568:8b =>ADHJ BOR >PUY\)>Zl :8b >Oegjloqwy|~'>mU y|8b:l 8>DHJ>DH ''Rgl :\YlblOlj^`OlY57Y bl !%)+: )+/ ') ')8: '8b8bCGIKORTVX[mfffjlnpfjsuwyl>OlblYb Yl l     !CDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~BM6(FH6U=9:LDE " ,uuKK6e//K##@zzuuU))}}__@@ppJJDDv;;j55}}ggPPnn\\WW}}]00vv{{ccyytt肂VVҏrVVccrrYKKɫ۾}}]UU{rr]XXRQQql4'&D/(R4!V>0' b<nlN?klk ''%++-33KTT>>///*** @_ Yd:d&MOJHw~ʋdT~D bҷ ~AZVJSYKQc@OC? 2:? AJ]cӋ.O<3& !;:(,AJ̐ tݗ-VA:8:(-6),CJ`ZOF CKL,F(5" 320<?JhQJA3,2 LȔ+ C,2.'3:'e:,AFB"*01?+ c! <,5 :-*;:-1,#39"  'YܽЋͺ C#:!;& a !01&+68:?,*!.ˋbLؙϼʿF :*6!ܾǗY')+2<(35@9a{ƾݹdؗtdO<(7.Ļ +6. 6:3,3<uyT̈ʓor۔tơҽc `J:)ً.* 0,#(-"gf!)AEQOZsqnі־aN]F<' cƾ *+!+0%,-&2,3<?3#(AJVՄpqnhВWTVKZC:' dӓy "*'),<:3,#,/2$?OdpqmKV]Q O,3"Ybtߕʕ}  */%#4)! ,Q£nqmt[PQ)ZC,wԾҘ۹ϕayv "(#/6!"!'9# Mmqnt_TUQR'J,}ʾʽߔΡbáӖw *:(6&9>< :3%,Gbn aWRVUVAY՘ݾԗb73<! &e90&-3XmoPUb+ZC|ɓعaѾۑҾ'A#)zy 6 8#_ jlg\hb&VA.uՒtֿϚԾt-& vz"5!"-iej"O,e z֗dǾc{ e9+fkݡ `F376 dɚҾLy˺?!bV<,%-,$&! v{͡վt cגٺY5&d d`F#-6)#)*89 ºṿaܹƙ 5$I ϸV?1!-,-"6>26" cӽ¾ /#6ٳaF383,7''9=6 ,aֻ͒+